Chum::Utils::RSNPAnalysisXMLFileReader - Loads in a *.rsnpa.xml file from an external analysis run.
Loads in a *.rsnpa.xml file from an external analysis run. These files have the format: <regulatory-polymorphism-analysis-file> <id>id from dbSNP or ORegAnno</id> <seqstack> <sequence name="rhma">AATCTTTGTTGCTTCTTCTAAACC/sequence <sequence name="patr">AATCTTCGTTGCTTCTTCTAAACC/sequence ..... </seqstack> <variants> <left-sequence>GTT/left-sequence <right-sequence>TTC/right-sequence <variant> <variant-sequence>AATCTTTGTTGATTCTTCTAAACC/variant-sequence <allele-sequence>/allele-sequence </variant> </variants> </regulatory-polymorphism-analysis-file>
Usage: my $rs2749024 = new Chum::Utils::RSNPAnalysisXMLFileReader(-file => "rs2749024.snpa.xml");
Stephen Montgomery (smontgom@bcsgc.bc.ca)
Usage : $rsnpafile->_load_file;
##NOTE: Private function, loads the analysis file into this object
Returns : nothing
Args : $analysis_file
Usage : $rsnpafile->analysis_file Returns : string containing location of analysis file Args : none
Usage : $rsnpafile->sequences_map; #Returns hashref
$rsnpafile->sequences_map('Homo sapiens'); #Returns string containing sequence
Returns : either a hashref of the sequences loaded or a specific sequence if arg 1 is specified
Args : id sequence_name, string (optional)
Usage : $rsnpafile->sequence_arr; #Returns arrayref Returns : an arrayref of Bio::Seq objects for the sequences defined in the xml file Args : none
Usage : $rsnpafile->sequence_ids; #Returns arrayref Returns : an arrayref of sequence ids for the sequences in the input xml file Args : none
Usage : $rsnpafile->left_flank_sequence; Returns : an string containing a sequence that 5' flanks the variant Args : none
Usage : $rsnpafile->right_flank_sequence; Returns : an string containing a sequence that 3' flanks the variant Args : none
Usage : $rsnpafile->variants; #Returns arrayref Returns : an arrayref of hashes containing variant sequences and alleles from the input xml file Args : none
Usage : $rsnpafile->get_flanked_allele_sequences; #Returns arrayref
Returns : an arrayref of hashes containing sequences with specified flank around them,
this is for shortening the length of the reference and variant sequences for more detailed analyses.
For instance, using 10bp flank around a variant instead of 500bp.
Args : $flank (positive integer)
$reference_id (string) name of a sequence
Usage : $rsnpafile->get_flanked_sequence_stack_obj;
this is for shortening the length of the reference and variant sequences for more detailed analyses.
For instance, using 10bp flank around a variant instead of 500bp.
Returns : a Chum::Stack object for input into analysis modules
Args : $flank (positive integer)
$reference_id (string) name of a sequence
Usage : $rsnpafile->get_sequence_stack_obj; Returns : a Chum::Stack object for input into analysis modules Args : $reference_id (string) name of a sequence
Usage : $rsnpafile->_get_reference_allele;
##NOTE: Private function
Returns : the allele in the reference sequence
Args : $reference_id (string) name of a sequence
Hey! The above document had some coding errors, which are explained below:
Deleting unknown formatting code T<>
Deleting unknown formatting code T<>
Deleting unknown formatting code G<>
Deleting unknown formatting code T<>
Deleting unknown formatting code T<>
Deleting unknown formatting code A<>